passlisted in Coinbase#2 by calls of 10 on this host
0.004 USDC
per call, as the listing declares it on eip155:
- Validation state
- pass
- Uptime, 7 / 30 / 90 days
- 100% / 100% / 100%
- Calls, trailing 30 days
- 1
- Unique payers, trailing 30 days
- 1
- Last called
- 2026-09-01 07:53 UTC
- First observed by TOLLderived
- 2026-09-10
- Pricederived
- 0.004 USDC
- Networks
- 1
How big is this endpoint among the ones like it?
No trace is drawn of this endpoint’s own volume. Its counters have changed 1 time across 29 observations, and 3 changes are the fewest this site will draw a trace through, because two points and a guess are not a series. Every observation is in the JSON.
At bio.halowerk.com, phage matching takes POST requests, is listed in the Coinbase registry, and falls under the "other" category by TOLL's rules.
On Base, phage matching asks 0.004 USDC per call.
Requests carry a json body with the fields spacers, max_mismatches and phage_sequence.
phage matching declares nothing about its output; validate flags that as advisory, not a verdict.
phage matching answered the sweep of 2026-09-15 with a valid 402, as at every sweep since 2026-09-11.
phage matching shares bio.halowerk.com with 9 other listed endpoints and is tied 2nd by calls with 8 others.
phage matching takes 9% of the calls counted across bio.halowerk.com.
In the trailing 30 days: one call, one payer.
phage matching was last called 15 days before the snapshot.
Closest in price to phage matching within the "other" category: gauge strata at api.truthbear.co and check at holidays.use.x402atlas.com.
phage matching is priced above 54% of comparable listings in the "other" category.
The wallet paid by phage matching is the payee of 1,553 endpoints across 67 hosts.
The price of phage matching is declared by 98 other listings in the "other" category too.
the payment options, as of 2026-09-15 21:20 UTC · method · pinnable
| registry | network | asset | amount | scheme | pay to |
|---|---|---|---|---|---|
| Coinbase | eip155: | USDC | 0.004 USDC | exact | 0x2880Ed…1C4E5E |
the checks, as of 2026-09-15 06:37 UTC · method · pinnableendpoint answered HTTP 402
bazaar.info.output· advisory, does not affect the verdict · output metadata is present (advisory)
Every sweep that observed this endpoint, newest first.
| observed, UTC | state | failed checks | sweep |
|---|---|---|---|
| 2026-09-15 06:37 UTC | pass | 1 | daily-2026-09-15 |
| 2026-09-14 06:05 UTC | pass | 1 | daily-2026-09-14 |
| 2026-09-13 05:57 UTC | pass | 1 | daily-2026-09-13 |
| 2026-09-12 08:15 UTC | pass | 1 | daily-2026-09-12 |
| 2026-09-11 12:41 UTC | pass | 1 | daily-2026-09-11 |
Presence in a registry, not liveness of the service (method). Newest first.
- listed in Coinbase
From the registry record, not validated by TOLL.the declared schema, as of 2026-09-01 07:53 UTC · method · live
The input and output block
{
"input": {
"body": {
"spacers": [
{
"id": "spacer-1",
"sequence": "GGCTAACCGTTCGATC"
},
{
"id": "spacer-2",
"sequence": "ATGCCTGAATTCGGCA"
}
],
"max_mismatches": 2,
"phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA"
},
"type": "http",
"method": "POST",
"bodyType": "json"
},
"output": null
}Cite this page
The pinned URL below renders this page from the snapshot of 2026-09-15 21:20 UTC and does not change; the live page does, every six hours. Data reuse is under CC BY 4.0 (terms).
Plain text
TOLL, "phage matching on bio.halowerk.com", snapshot of 2026-09-15 21:20 UTC. https://tollindex.com/e/bio-halowerk-com-v1-phage-matching-d15992/at/2026-09-15T21-20Z. Accessed [access date].
BibTeX
@misc{toll-e-bio-halowerk-com-v1-phage-matching-d15992-2026-09-15T21-20Z,
author = {TOLL},
title = {phage matching on bio.halowerk.com},
howpublished = {\url{https://tollindex.com/e/bio-halowerk-com-v1-phage-matching-d15992/at/2026-09-15T21-20Z}},
year = {2026},
month = {9},
note = {Pinned view of the snapshot of 2026-09-15 21:20 UTC. Accessed [access date].}
}None yet. Anything submitted through the form below is published here with its outcome.