TOLL

What software pays for, recorded every six hours.

Snapshot
2026-09-15 21:20 UTC
Sweep
daily-2026-09-15 · finished 2026-09-15 07:10 UTC
Listed
16,178

phage matching derived

bio.halowerk.comOtherderived

POST https://bio.halowerk.com/v1/phage-matching

passlisted in Coinbase#2 by calls of 10 on this host

0.004 USDC

per call, as the listing declares it on eip155:8453

Compare with anotherEvery figure as JSONCite this page

the price, as of 2026-09-15 21:20 UTC · method · pinnable

Validation state
pass
as of 2026-09-15 06:37 UTC · method · pinnable · sweep daily-2026-09-15
Uptime, 7 / 30 / 90 days
100% / 100% / 100%
as of 2026-09-15 06:37 UTC · method · pinnable · 5 of 5 in 7d, 5 of 5 in 30d, 5 of 5 in 90d
Calls, trailing 30 days
1
as of 2026-09-15 21:20 UTC · method · pinnable
Unique payers, trailing 30 days
1
as of 2026-09-15 21:20 UTC · method · pinnable
Last called
2026-09-01 07:53 UTC
as of 2026-09-15 21:20 UTC · method · pinnable
First observed by TOLLderived
2026-09-10
as of 2026-09-10 19:08 UTC · method · pinnable · observation began 10 September 2026; listings that predate it show that date
Pricederived
0.004 USDC
as of 2026-09-15 21:20 UTC · method · pinnable · on eip155:8453
Networks
1
as of 2026-09-15 21:20 UTC · method · pinnable

Counters

29 observations, 1 of them a change, fewer than the 3 a trace needs

How big is this endpoint among the ones like it?

1 call100,000this endpoint
Calls counted in the trailing thirty days across the 2,772 endpoints in Other that carry counters, binned on a logarithmic scale because the range runs over five orders of magnitude. The marked bin is this endpoint, at 1: 1,040 in the category are counted higher and 1,731 lower.

No trace is drawn of this endpoint’s own volume. Its counters have changed 1 time across 29 observations, and 3 changes are the fewest this site will draw a trace through, because two points and a guess are not a series. Every observation is in the JSON.

In words

At bio.halowerk.com, phage matching takes POST requests, is listed in the Coinbase registry, and falls under the "other" category by TOLL's rules.

On Base, phage matching asks 0.004 USDC per call.

Requests carry a json body with the fields spacers, max_mismatches and phage_sequence.

phage matching declares nothing about its output; validate flags that as advisory, not a verdict.

phage matching answered the sweep of 2026-09-15 with a valid 402, as at every sweep since 2026-09-11.

phage matching shares bio.halowerk.com with 9 other listed endpoints and is tied 2nd by calls with 8 others.

phage matching takes 9% of the calls counted across bio.halowerk.com.

In the trailing 30 days: one call, one payer.

phage matching was last called 15 days before the snapshot.

Closest in price to phage matching within the "other" category: gauge strata at api.truthbear.co and check at holidays.use.x402atlas.com.

phage matching is priced above 54% of comparable listings in the "other" category.

The wallet paid by phage matching is the payee of 1,553 endpoints across 67 hosts.

The price of phage matching is declared by 98 other listings in the "other" category too.

Payment options as declared

the payment options, as of 2026-09-15 21:20 UTC · method · pinnable

Every payment option declared on this listing
registrynetworkassetamountschemepay to
Coinbaseeip155:8453USDC0.004 USDCexact0x2880Ed…1C4E5E

Preflight checks at the last sweep

the checks, as of 2026-09-15 06:37 UTC · method · pinnableendpoint answered HTTP 402

  • bazaar.info.output · advisory, does not affect the verdict · output metadata is present (advisory)

Validation history, 90 days

Every sweep that observed this endpoint, newest first.

Validation observations over the last 90 days
observed, UTCstatefailed checkssweep
2026-09-15 06:37 UTCpass1daily-2026-09-15
2026-09-14 06:05 UTCpass1daily-2026-09-14
2026-09-13 05:57 UTCpass1daily-2026-09-13
2026-09-12 08:15 UTCpass1daily-2026-09-12
2026-09-11 12:41 UTCpass1daily-2026-09-11

Registry presence

Presence in a registry, not liveness of the service (method). Newest first.

  1. listed in Coinbase

Declared input and output, as listed

From the registry record, not validated by TOLL.the declared schema, as of 2026-09-01 07:53 UTC · method · live

The input and output block
{
  "input": {
    "body": {
      "spacers": [
        {
          "id": "spacer-1",
          "sequence": "GGCTAACCGTTCGATC"
        },
        {
          "id": "spacer-2",
          "sequence": "ATGCCTGAATTCGGCA"
        }
      ],
      "max_mismatches": 2,
      "phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA"
    },
    "type": "http",
    "method": "POST",
    "bodyType": "json"
  },
  "output": null
}
Cite this page

The pinned URL below renders this page from the snapshot of 2026-09-15 21:20 UTC and does not change; the live page does, every six hours. Data reuse is under CC BY 4.0 (terms).

Plain text

TOLL, "phage matching on bio.halowerk.com", snapshot of 2026-09-15 21:20 UTC. https://tollindex.com/e/bio-halowerk-com-v1-phage-matching-d15992/at/2026-09-15T21-20Z. Accessed [access date].

BibTeX

@misc{toll-e-bio-halowerk-com-v1-phage-matching-d15992-2026-09-15T21-20Z,
  author = {TOLL},
  title = {phage matching on bio.halowerk.com},
  howpublished = {\url{https://tollindex.com/e/bio-halowerk-com-v1-phage-matching-d15992/at/2026-09-15T21-20Z}},
  year = {2026},
  month = {9},
  note = {Pinned view of the snapshot of 2026-09-15 21:20 UTC. Accessed [access date].}
}

Reports and replies about this endpoint

None yet. Anything submitted through the form below is published here with its outcome.

Report an error about phage matching, or reply as the named seller

No account, no token. Published unedited with its outcome, upheld or not. Do not include personal data.

Kind

Published as typed. Optional.

10 to 4,000 characters.

Verify with the payee wallet (optional, EVM)

Sign this message with the wallet named on the page and paste the signature; it is checked, stored, never published. TOLL reply about endpoint d15992c69c627d72d6704156ab7a5f237c0438f429176e136ec3d93e28663a77 from wallet 0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E

The 0x address named as payee on this page, 42 characters.

The hex signature of the message above, starting 0x.